View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4298_low_9 (Length: 508)
Name: NF4298_low_9
Description: NF4298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4298_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 3e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 3e-83
Query Start/End: Original strand, 311 - 491
Target Start/End: Complemental strand, 50550576 - 50550396
Alignment:
| Q |
311 |
ttttatatgatgaagtttgacatggctgaagatagagataaagtcattggagagggtccgtggatgatctttgatcactaccttgctgttgctaaatgga |
410 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
50550576 |
ttttatacgatgaagtttgacatggctgaagatagagataaagtcattggagagggtctgtggatgatctttgatcattaccttactgttgctaaatgga |
50550477 |
T |
 |
| Q |
411 |
gcccggagttcgtatcatccactgctaagattgaaaagacgatggtttgggttcgtttcccagggatgagcttgatttact |
491 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50550476 |
gcctggagttcgtatcatccactgctaagattgaaaagacgatggtttgggttcgtttcccaggcatgagcttgatttact |
50550396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University