View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4298_low_9 (Length: 508)

Name: NF4298_low_9
Description: NF4298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4298_low_9
NF4298_low_9
[»] chr4 (1 HSPs)
chr4 (311-491)||(50550396-50550576)


Alignment Details
Target: chr4 (Bit Score: 157; Significance: 3e-83; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 157; E-Value: 3e-83
Query Start/End: Original strand, 311 - 491
Target Start/End: Complemental strand, 50550576 - 50550396
Alignment:
311 ttttatatgatgaagtttgacatggctgaagatagagataaagtcattggagagggtccgtggatgatctttgatcactaccttgctgttgctaaatgga 410  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||||||||||||    
50550576 ttttatacgatgaagtttgacatggctgaagatagagataaagtcattggagagggtctgtggatgatctttgatcattaccttactgttgctaaatgga 50550477  T
411 gcccggagttcgtatcatccactgctaagattgaaaagacgatggtttgggttcgtttcccagggatgagcttgatttact 491  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
50550476 gcctggagttcgtatcatccactgctaagattgaaaagacgatggtttgggttcgtttcccaggcatgagcttgatttact 50550396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University