View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4299-Insertion-1 (Length: 54)
Name: NF4299-Insertion-1
Description: NF4299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4299-Insertion-1 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 44; Significance: 6e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 6e-17
Query Start/End: Original strand, 7 - 54
Target Start/End: Original strand, 22039709 - 22039756
Alignment:
| Q |
7 |
aaaactccagtgttagttcatgatggaaaacctctatgtgagtctatg |
54 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22039709 |
aaaactccagtgttggttcatgatggaaaacctctatgtgagtctatg |
22039756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 28; Significance: 0.0000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 28; E-Value: 0.0000002
Query Start/End: Original strand, 7 - 50
Target Start/End: Complemental strand, 40331250 - 40331207
Alignment:
| Q |
7 |
aaaactccagtgttagttcatgatggaaaacctctatgtgagtc |
50 |
Q |
| |
|
|||||||||||| | ||||||||||||||||| |||||||||| |
|
|
| T |
40331250 |
aaaactccagtgctggttcatgatggaaaacccatatgtgagtc |
40331207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University