View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4299-Insertion-14 (Length: 82)
Name: NF4299-Insertion-14
Description: NF4299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4299-Insertion-14 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 2e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 2e-39
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 37664019 - 37663938
Alignment:
| Q |
1 |
gttgcgacttcagcctttcaatgatagggtttacttcccaaaatggtatctgaaggggataagaagcagcccaacaaattcc |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37664019 |
gttgcgacttcagcctttcaatgatagggtttacttcccaaaatggtatctgaaggggataagaagcagcccaacaaattcc |
37663938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 55427966 - 55427917
Alignment:
| Q |
8 |
cttcagcctttcaatgatagggtttacttcccaaaatggtatctgaaggg |
57 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
55427966 |
cttcagcctttgaatgatagggtatacttcccaaaatggtatctcaaggg |
55427917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University