View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4299-Insertion-16 (Length: 137)
Name: NF4299-Insertion-16
Description: NF4299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4299-Insertion-16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 1e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 1e-45
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 26374707 - 26374846
Alignment:
| Q |
1 |
gtattatggctttggattccgtggattttatgtatgtcaagnnnnnnnttta---gctttaacgtagataaatatctttcagtttcaatgcaaatttcaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26374707 |
gtattatggctttggattccgtggattttatgtatgtcaagaataaaaataatttgctttaacgtagataaatatctttcagtttcaatgcaaatttcaa |
26374806 |
T |
 |
| Q |
98 |
gtatttaaccatcaaatgtgtgttattgggaattctcatc |
137 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26374807 |
gtatttaactatcaaatgtgtgttattgggaattctcatc |
26374846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University