View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4299-Insertion-2 (Length: 63)
Name: NF4299-Insertion-2
Description: NF4299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4299-Insertion-2 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 3e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 3e-22
Query Start/End: Original strand, 3 - 63
Target Start/End: Complemental strand, 43723057 - 43722998
Alignment:
| Q |
3 |
attgcaactgagaatccaaattaaacagctgaactgggggaacctcgtctctcgccggaga |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43723057 |
attgcaactgagaatccaaattaaacagctgaact-ggggaacctcgtctctcgccggaga |
43722998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University