View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4299-Insertion-24 (Length: 203)

Name: NF4299-Insertion-24
Description: NF4299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4299-Insertion-24
NF4299-Insertion-24
[»] chr6 (2 HSPs)
chr6 (1-159)||(9696284-9696440)
chr6 (152-203)||(9695923-9695974)


Alignment Details
Target: chr6 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 9696440 - 9696284
Alignment:
1 ataaatgccctaaatata--aagaataaactaaacagcttatatctattctagtacatcaaatttctcgagtaaaaaata--acatcaaattgccactac 96  Q
    ||||||||||||||||||  ||||||||||||||||||||||  |||||||||||||||||||||| ||||||||||| |  ||||||||||||||||||    
9696440 ataaatgccctaaatatataaagaataaactaaacagcttat--ctattctagtacatcaaatttcccgagtaaaaaaaagtacatcaaattgccactac 9696343  T
97 tgttttttaatgtcatatagctatgtgaaaaatagataccctacaccaattatatggtgcaac 159  Q
    | |||||| ||||||||||||||||||||||||||||||    ||||||||||||||||||||    
9696342 tattttttgatgtcatatagctatgtgaaaaatagatac----caccaattatatggtgcaac 9696284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 152 - 203
Target Start/End: Complemental strand, 9695974 - 9695923
Alignment:
152 ggtgcaacaatgatgataattattaactttaatgagataagtttttctcttt 203  Q
    ||||||| ||||||||||||||||||||||||| ||||||||||||||||||    
9695974 ggtgcaataatgatgataattattaactttaataagataagtttttctcttt 9695923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University