View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4299-Insertion-24 (Length: 203)

Name: NF4299-Insertion-24

Description: NF4299

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4299-Insertion-24

[»] chr6 (2 HSPs)

Target: chr6 (Bit Score: 97; Significance: 7e-48; HSPs: 2)

Name: chr6

Description:

Target: chr6; HSP #1

Raw Score: 97; E-Value: 7e-48

Query Start/End: Original strand, 1 - 159

Target Start/End: Complemental strand, 9696440 - 9696284

Alignment:

Q	1	ataaatgccctaaatata--aagaataaactaaacagcttatatctattctagtacatcaaatttctcgagtaaaaaata--acatcaaattgccactac	96	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\| \| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	9696440	ataaatgccctaaatatataaagaataaactaaacagcttat--ctattctagtacatcaaatttcccgagtaaaaaaaagtacatcaaattgccactac	9696343	T

Q	97	tgttttttaatgtcatatagctatgtgaaaaatagataccctacaccaattatatggtgcaac	159	Q
		\| \|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	9696342	tattttttgatgtcatatagctatgtgaaaaatagatac----caccaattatatggtgcaac	9696284	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2

Raw Score: 44; E-Value: 3e-16

Query Start/End: Original strand, 152 - 203

Target Start/End: Complemental strand, 9695974 - 9695923

Alignment:

Q	152	ggtgcaacaatgatgataattattaactttaatgagataagtttttctcttt	203	Q
		\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	9695974	ggtgcaataatgatgataattattaactttaataagataagtttttctcttt	9695923	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]