View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4299_low_19 (Length: 359)
Name: NF4299_low_19
Description: NF4299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4299_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 7e-34; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 51 - 136
Target Start/End: Complemental strand, 12395470 - 12395385
Alignment:
| Q |
51 |
gcttataaggctgccaaggattcaaagaacaacaaagagttatgcgcttgtgttggatctatgttatgctcagtggttactggatt |
136 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12395470 |
gcttataaggctgccaaggattcaaagaataacaaggagttatgcgcttgtgttggatctatgttatgctcagtggttcctggatt |
12395385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 90 - 143
Target Start/End: Original strand, 19938101 - 19938154
Alignment:
| Q |
90 |
ttatgcgcttgtgttggatctatgttatgctcagtggttactggattcaaaaac |
143 |
Q |
| |
|
|||||| ||| ||| |||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
19938101 |
ttatgcacttatgtaggatctatgttatgctcagtggttcctggattcagaaac |
19938154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 51 - 138
Target Start/End: Complemental strand, 12357915 - 12357828
Alignment:
| Q |
51 |
gcttataaggctgccaaggattcaaagaacaacaaagagttatgcgcttgtgttggatctatgttatgctcagtggttactggattca |
138 |
Q |
| |
|
|||||| | ||| |||| |||||||| || | ||| ||||||||| ||| |||||||||||||||||||| |||||| ||| ||||| |
|
|
| T |
12357915 |
gcttatgatgctaccaaagattcaaaaaatagcaaggagttatgcacttatgttggatctatgttatgcttcgtggttcctgaattca |
12357828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 81 - 143
Target Start/End: Complemental strand, 12405444 - 12405382
Alignment:
| Q |
81 |
aacaaagagttatgcgcttgtgttggatctatgttatgctcagtggttactggattcaaaaac |
143 |
Q |
| |
|
|||||||| ||||||| ||||||||||||| || |||||||||| || ||||||||| |||| |
|
|
| T |
12405444 |
aacaaagatttatgcgattgtgttggatctttgctatgctcagttgtccctggattcagaaac |
12405382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University