View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4299_low_26 (Length: 322)
Name: NF4299_low_26
Description: NF4299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4299_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 1323832 - 1323530
Alignment:
| Q |
1 |
ctagctgagctgtaatttgcgcagccttttcagctgctgtggctttcaattcagtcttctccctatatttgaaagattataagataagataagatattgc |
100 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1323832 |
ctagctgagctgtaatttgctcaaccttttcagctgctgtggctttcaattcagtcttctccctatatttgaaagattataagataagataagatattgc |
1323733 |
T |
 |
| Q |
101 |
gtatatgagactttagaaataattattgttaaagttaggttattttaatgatttgacaattatgaacgactgacggtgtaaaaaatatttacgttaacga |
200 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||||||||||||||||| ||| |||||||||||| ||||||||||||||||| || |
|
|
| T |
1323732 |
gtatatgagattttagaaataattatcgttgaagttaggttattttaatgatctgataattatgaacgattgacggtgtaaaaaata-----------ga |
1323644 |
T |
 |
| Q |
201 |
tgaatgaattaatattgtttatataattctaataggagaaggtgtttgagatttacctcaacaatttttggagttcttcaatagcttcatcatagccctt |
300 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1323643 |
tgaatgaattaatattgtgtatataattctaataggagaagttgtttgagatttacctcaacaatttttggagttcttcaatagcttcatcatagccctt |
1323544 |
T |
 |
| Q |
301 |
tcccatttcttctc |
314 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1323543 |
tcccatttcttctc |
1323530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University