View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4299_low_37 (Length: 240)
Name: NF4299_low_37
Description: NF4299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4299_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 45039102 - 45038873
Alignment:
| Q |
1 |
aattttaaccaataataatcatgtagtgcaagtcgagaaatacattgg---------gataaggtttgctcgattaaggagtttggaggactacagtgag |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||||||||||||||||| ||| | |
|
|
| T |
45039102 |
aattttaaccaataataatcatgtagtgcaagttgagaaatacattggatacactgggataaggtttgctcaattaaggagtttggaggactacggtgcg |
45039003 |
T |
|
| Q |
92 |
aaagtttaagaaatttaatttggtattgttaggaaaatgaggttggaggttgtactttgaccaaagttttggcggcaaaatatgaggttttagtgggttg |
191 |
Q |
| |
|
|| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45039002 |
aaggtttaagaaatttaatttggtattggtaggaaaatgaggttggaggttgtacattgaccaaagttttggcggcaaaatatgaggttttagtgggttg |
45038903 |
T |
|
| Q |
192 |
aattaggagaagagggaggaaggtgtcgac |
221 |
Q |
| |
|
||||||||||| ||||||||||| |||||| |
|
|
| T |
45038902 |
aattaggagaacagggaggaaggcgtcgac |
45038873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University