View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4301-Insertion-1 (Length: 167)
Name: NF4301-Insertion-1
Description: NF4301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4301-Insertion-1 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 6e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 6e-85
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 8060709 - 8060543
Alignment:
| Q |
1 |
atgacccactagatatattcacgggcacttgcttccctttgttgtttagcaaaaagccacaaaatcagagcctctcttttatcaaatttgtcacttagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8060709 |
atgacccactagatatattcacgggcacttgcttccctttgttgtttagcaaaaagccacaaaatcagagtctctcttttatcaaatttgtcacttagtt |
8060610 |
T |
|
| Q |
101 |
gtgtggtgcttgacgcttgtatgagccatatatatgtaaatttatgggttcactaaaagcacttctt |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8060609 |
gtgtggtgcttgacgcttgtatgagccatatatatctaaatttatgggttcactaaaagcacttctt |
8060543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University