View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4301-Insertion-2 (Length: 135)
Name: NF4301-Insertion-2
Description: NF4301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4301-Insertion-2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 8e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 8e-53
Query Start/End: Original strand, 10 - 129
Target Start/End: Complemental strand, 35210619 - 35210497
Alignment:
| Q |
10 |
attgaatttgtgaagcaccttcatagccatttggatagcaattatacattga---aaaactgaaaaattcttactccaagacatccttcttcttttgaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35210619 |
attgaatttgtgaagcaccttcatagccatttggatagcaatgatacattgatcaaaaactgaaaaattcttactccaagacatccttcttcttttgaaa |
35210520 |
T |
|
| Q |
107 |
gatgcatcatgtctcaactgaac |
129 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35210519 |
gatgcatcatgtctcaactgaac |
35210497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University