View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4301_low_7 (Length: 360)
Name: NF4301_low_7
Description: NF4301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4301_low_7 |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0168 (Bit Score: 116; Significance: 6e-59; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 17 - 162
Target Start/End: Complemental strand, 23806 - 23664
Alignment:
| Q |
17 |
acaaaacttaatgaaaaagaaaatgcaagtggcaaaggaggttatggaaacccaaacatggagaaaccaatcttattggtttaaggagtggcaaatgagt |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23806 |
acaaaacttaatgaaaaagaaaatacaagt---aaaggaggttatggaaacccaaacatggagaaaccaatcttattggttaaaggagtggcaaatgagc |
23710 |
T |
 |
| Q |
117 |
ctataaatagatgatatccttcattccttgggggagcacgttttgg |
162 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23709 |
ctataaatagatggtatccttcattccttgggggagcacgttttgg |
23664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University