View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4302-Insertion-1 (Length: 53)

Name: NF4302-Insertion-1
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4302-Insertion-1
NF4302-Insertion-1
[»] chr7 (2 HSPs)
chr7 (1-53)||(26056910-26056962)
chr7 (1-53)||(26066269-26066321)


Alignment Details
Target: chr7 (Bit Score: 49; Significance: 6e-20; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 49; E-Value: 6e-20
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 26056910 - 26056962
Alignment:
1 ccactaacacaccatattgaatagataacaagcattcaaaaataatgtgtgca 53  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||    
26056910 ccactaacacaccatattgaatagataacgagcattcaaaaataatgtgtgca 26056962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 49; E-Value: 6e-20
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 26066269 - 26066321
Alignment:
1 ccactaacacaccatattgaatagataacaagcattcaaaaataatgtgtgca 53  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||    
26066269 ccactaacacaccatattgaatagataacgagcattcaaaaataatgtgtgca 26066321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University