View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-13 (Length: 127)
Name: NF4302-Insertion-13
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-13 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 5e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 5e-66
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 7626533 - 7626407
Alignment:
| Q |
1 |
tgtagaccatagatattgagaggacgaaggagcatcaaaaggaatacaaagaagattagaaagtgaaagttagcctaacatggaagctagctatataaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7626533 |
tgtagaccatagatattgagaggacgaaggagcatcaaaaggaatacaaagaagattagaaagtgaaagttagcctaacatggaagctagctatataaat |
7626434 |
T |
 |
| Q |
101 |
ggcaaatataacctgacaaaaatttca |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
7626433 |
ggcaaatataacctgacaaaaatttca |
7626407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University