View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-18 (Length: 41)
Name: NF4302-Insertion-18
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-18 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 36; Significance: 0.000000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.000000000002
Query Start/End: Original strand, 6 - 41
Target Start/End: Complemental strand, 13872534 - 13872499
Alignment:
| Q |
6 |
agcaaccacttcatgtaagccattcactaatcagtt |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
13872534 |
agcaaccacttcatgtaagccattcactaatcagtt |
13872499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.000000000002
Query Start/End: Original strand, 6 - 41
Target Start/End: Complemental strand, 14012659 - 14012624
Alignment:
| Q |
6 |
agcaaccacttcatgtaagccattcactaatcagtt |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
14012659 |
agcaaccacttcatgtaagccattcactaatcagtt |
14012624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University