View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-20 (Length: 81)
Name: NF4302-Insertion-20
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-20 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 76; Significance: 8e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 8e-36
Query Start/End: Original strand, 2 - 81
Target Start/End: Original strand, 10670398 - 10670477
Alignment:
| Q |
2 |
taggaacggttcttgtcgtttattatagttggacatgtggcttgactataatagttcttcaaatatatggaataacctaa |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10670398 |
taggaacggttcttgtcgtttattatagttggacatgtggcttgactataatagttcttcgaatatatggaataacctaa |
10670477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 76; Significance: 8e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 8e-36
Query Start/End: Original strand, 2 - 81
Target Start/End: Complemental strand, 28699606 - 28699527
Alignment:
| Q |
2 |
taggaacggttcttgtcgtttattatagttggacatgtggcttgactataatagttcttcaaatatatggaataacctaa |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28699606 |
taggaacggttcttgtcgtttattatagttggacatgtggcttgactataatagttcttcgaatatatggaataacctaa |
28699527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 69; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 1e-31
Query Start/End: Original strand, 2 - 81
Target Start/End: Complemental strand, 42860245 - 42860165
Alignment:
| Q |
2 |
taggaacggttcttgtcgtttattatagttgg-acatgtggcttgactataatagttcttcaaatatatggaataacctaa |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42860245 |
taggaacggttcttgtcgtttattatagttgggacatgtggcttgactataatagttcttcgaatatatggaataacctaa |
42860165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 2 - 37
Target Start/End: Original strand, 9406772 - 9406807
Alignment:
| Q |
2 |
taggaacggttcttgtcgtttattatagttggacat |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9406772 |
taggaacggttcttgtcgtttattatagttggacat |
9406807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University