View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-3 (Length: 117)
Name: NF4302-Insertion-3
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-3 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 1e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 26504461 - 26504579
Alignment:
| Q |
1 |
ttacctaagagacatttaataaaa-aactttaatgctacaaagagttctttacagcttcataattgcgaaaaaccttttaattatttttagtagaatacg |
99 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
26504461 |
ttacctaagagacatttaataaaaaaactttaatgctacaaagagttctttacagcttcataattgcgaaaaactttttaattgtttttagtagaatacg |
26504560 |
T |
|
| Q |
100 |
agattt-tacattataaag |
117 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
26504561 |
ggatttgtacattataaag |
26504579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University