View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-30 (Length: 167)
Name: NF4302-Insertion-30
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-30 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 2e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 12 - 167
Target Start/End: Original strand, 45694740 - 45694895
Alignment:
| Q |
12 |
ctccaaaggtttcaaaccaaccctggatggctctactgactgatgacaatgtatggctgaactctttggacattctccacttaaatcaacttttgatgat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45694740 |
ctccaaaggtttcaaaccaaccctggatggctccactgactgatgacaatgtatggctgaactctttggacattctacacttaaatcaacttttgatgat |
45694839 |
T |
|
| Q |
112 |
tcgcaaggattccttcctattgcagctgcatctttgttctttgctcccacacgttc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45694840 |
tcgcaaggattccttcctattgcagctgcatctttgttctttgctcccacacgttc |
45694895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University