View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-31 (Length: 87)
Name: NF4302-Insertion-31
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-31 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 1e-41; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 2 - 87
Target Start/End: Complemental strand, 7036585 - 7036500
Alignment:
| Q |
2 |
atataccacagatgcttgattatgtagtttatttatctttaaatttacagttgtaataatagggaaaattgcactcttatgatttc |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7036585 |
atataccacagatgcttgattatgtagtttatttatctttaaatttacagttgtaataatagggaaaattgcactcttatgatttc |
7036500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 5e-28
Query Start/End: Original strand, 13 - 87
Target Start/End: Complemental strand, 7897800 - 7897726
Alignment:
| Q |
13 |
atgcttgattatgtagtttatttatctttaaatttacagttgtaataatagggaaaattgcactcttatgatttc |
87 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
7897800 |
atgcttgattatgtagtttgtttatctttaaatttacagttgtaataatagagaaaattccactcttatgatttc |
7897726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 13 - 87
Target Start/End: Complemental strand, 7039693 - 7039620
Alignment:
| Q |
13 |
atgcttgattatgtagtttatttatctttaaatttacagttgtaataatagggaaaattgcactcttatgatttc |
87 |
Q |
| |
|
|||||||||| |||| |||||||||||| | ||||||||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
7039693 |
atgcttgattgtgtaatttatttatcttcagatttacagttgtaataata-ggaaaattgcactgttgtgatttc |
7039620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 29 - 87
Target Start/End: Complemental strand, 29377113 - 29377055
Alignment:
| Q |
29 |
tttatttatctttaaatttacagttgtaataatagggaaaattgcactcttatgatttc |
87 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| |||||||| | ||||| ||||||| |
|
|
| T |
29377113 |
tttatttatctttaaatttgcggttgtaataatatggaaaattactctcttgtgatttc |
29377055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University