View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-32 (Length: 55)
Name: NF4302-Insertion-32
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-32 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 47; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 52772978 - 52772924
Alignment:
| Q |
1 |
ggatgttctttattaatgctaataatcctaagccgacaagaaaaggaaaataata |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
52772978 |
ggatgttctttattaatgctaataatcctaagcagacaagaaaaggaaaacaata |
52772924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University