View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-37 (Length: 126)
Name: NF4302-Insertion-37
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-37 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 7e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 7e-53
Query Start/End: Original strand, 6 - 126
Target Start/End: Original strand, 5970836 - 5970955
Alignment:
| Q |
6 |
caaaaagctaggaggggtatctcaaagagcaaaaaggaagattatacataattagaagatgtgttgttatgcttctttgttggcatgactaaatcattgt |
105 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5970836 |
caaaaagctaggaggc-tatctcaaagagcaaaagggaagattatacataattagaagatgtgttgttatgcttctttgttggcatgactaaatcattgt |
5970934 |
T |
|
| Q |
106 |
tgatagagcaaatgcactcaa |
126 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5970935 |
tgatagagcaaatgcactcaa |
5970955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University