View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-39 (Length: 58)
Name: NF4302-Insertion-39
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-39 |
 | |
|
| [»] scaffold0148 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0148 (Bit Score: 56; Significance: 5e-24; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 56; E-Value: 5e-24
Query Start/End: Original strand, 3 - 58
Target Start/End: Original strand, 25116 - 25171
Alignment:
| Q |
3 |
ttaagagggttgtagtttcattgtcgagcatggtcaccacatttgacatgtgtgga |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25116 |
ttaagagggttgtagtttcattgtcgagcatggtcaccacatttgacatgtgtgga |
25171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 21917274 - 21917325
Alignment:
| Q |
7 |
gagggttgtagtttcattgtcgagcatggtcaccacatttgacatgtgtgga |
58 |
Q |
| |
|
|||||||||||||||| | || |||||||||||||||||||||||||||||| |
|
|
| T |
21917274 |
gagggttgtagtttcactctctagcatggtcaccacatttgacatgtgtgga |
21917325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University