View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4302-Insertion-39 (Length: 58)

Name: NF4302-Insertion-39
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4302-Insertion-39
NF4302-Insertion-39
[»] scaffold0148 (1 HSPs)
scaffold0148 (3-58)||(25116-25171)
[»] chr1 (1 HSPs)
chr1 (7-58)||(21917274-21917325)


Alignment Details
Target: scaffold0148 (Bit Score: 56; Significance: 5e-24; HSPs: 1)
Name: scaffold0148
Description:

Target: scaffold0148; HSP #1
Raw Score: 56; E-Value: 5e-24
Query Start/End: Original strand, 3 - 58
Target Start/End: Original strand, 25116 - 25171
Alignment:
3 ttaagagggttgtagtttcattgtcgagcatggtcaccacatttgacatgtgtgga 58  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25116 ttaagagggttgtagtttcattgtcgagcatggtcaccacatttgacatgtgtgga 25171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 21917274 - 21917325
Alignment:
7 gagggttgtagtttcattgtcgagcatggtcaccacatttgacatgtgtgga 58  Q
    |||||||||||||||| | || ||||||||||||||||||||||||||||||    
21917274 gagggttgtagtttcactctctagcatggtcaccacatttgacatgtgtgga 21917325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University