View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-41 (Length: 120)
Name: NF4302-Insertion-41
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 46729773 - 46729659
Alignment:
| Q |
1 |
cgaatacaataaacaaacataactaaagtggtccacgacggtggattgagctagcatgttggcggcaacttggatatccttaaatggggttaacgtacga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46729773 |
cgaatacaataaacaaacataactaaagtggtccacgacggtggattgagctagcatgttgtcggcaacttggatatccttgaatggggttaacgtacga |
46729674 |
T |
 |
| Q |
101 |
gacccaagcatcaaa |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46729673 |
gacccaagcatcaaa |
46729659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University