View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-47 (Length: 157)
Name: NF4302-Insertion-47
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 9e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 9e-53
Query Start/End: Original strand, 4 - 148
Target Start/End: Complemental strand, 39512137 - 39511994
Alignment:
| Q |
4 |
gaaattggattaagtgcagtcacattattgtgcagtcaggtgcagtcggcacctcagaaccgtccaatctttatcggacggttcagatttcaaaacagtt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| || |||||| |||| |
|
|
| T |
39512137 |
gaaattggattaagtgcagtcacattattatgcagtcaggtgcagtcggcacctcagaaccgtccaatatttatcggacggttcaaatctcaaaatagtt |
39512038 |
T |
|
| Q |
104 |
tttgattttcggtttaatatacattactgagttttaaatttggat |
148 |
Q |
| |
|
||||| |||| |||||||||| | ||||||||||||||||||||| |
|
|
| T |
39512037 |
tttga-tttctgtttaatataaagtactgagttttaaatttggat |
39511994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University