View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-51 (Length: 66)
Name: NF4302-Insertion-51
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-51 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 6e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 6e-30
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 12861596 - 12861661
Alignment:
| Q |
1 |
tccggtcagtctctgcaattttctccgtcatcctaagaacaccttcgttggattctggaacgctgc |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12861596 |
tccggtcagtctctgcaattttctccgtcatcctaagaacaccttcgttggattctggaacgctgc |
12861661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 12843885 - 12843820
Alignment:
| Q |
1 |
tccggtcagtctctgcaattttctccgtcatcctaagaacaccttcgttggattctggaacgctgc |
66 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12843885 |
tccggttagtctctgcaactttctccgtcatcctaagaacaccttcgttggattctggaacgctgc |
12843820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University