View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-52 (Length: 118)
Name: NF4302-Insertion-52
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-52 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 7e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 7e-59
Query Start/End: Original strand, 4 - 118
Target Start/End: Original strand, 43465692 - 43465806
Alignment:
| Q |
4 |
gatttggctaccgtgatttccaatgctgctaaggaagggattccgattccagttggtgagttgaagcgttggatgattcagattctttgtggacttgatg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43465692 |
gatttggctaccgtgatttccaatgctgctaaggaagggattccgattccagttggtgagttgaagcgttggatgattcagattctttgtggacttgatg |
43465791 |
T |
 |
| Q |
104 |
cttgtcatcggaata |
118 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43465792 |
cttgtcatcggaata |
43465806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University