View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-56 (Length: 47)
Name: NF4302-Insertion-56
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-56 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.000000000000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.000000000000003
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 12366642 - 12366682
Alignment:
| Q |
7 |
tctcaacccatcactctcacctcagccttgtctcttccaag |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12366642 |
tctcaacccatcactctcacctcagccttgtctcttccaag |
12366682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.000000000003
Query Start/End: Original strand, 4 - 43
Target Start/End: Original strand, 12346417 - 12346456
Alignment:
| Q |
4 |
acatctcaacccatcactctcacctcagccttgtctcttc |
43 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12346417 |
acatctcaactcatcactctcacctcagccttgtctcttc |
12346456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University