View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-6 (Length: 56)
Name: NF4302-Insertion-6
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 35; Significance: 0.00000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 22 - 56
Target Start/End: Original strand, 38756462 - 38756496
Alignment:
| Q |
22 |
ttcttcttcttctccaagttcacatgacccaaagt |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38756462 |
ttcttcttcttctccaagttcacatgacccaaagt |
38756496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University