View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-60 (Length: 275)
Name: NF4302-Insertion-60
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-60 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 34320322 - 34320047
Alignment:
| Q |
1 |
aaatgtggcctcaaattttctggcctaggcaatatcagggctggatgccctcagacatgattattcttacaattcctagcttttataatatgcatgatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34320322 |
aaatgtggcctcaaattttctggccttggcaatatcagggctggatgccttcagacatgattattattacaattcctagcttttataatatgcatgatat |
34320223 |
T |
 |
| Q |
101 |
ggagataaatttaatttaaaaa-gttatcaatgtctaatcttatctttgattttcaatggatagttataagtatagtgggattaaacttgactacttgag |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34320222 |
ggagataaatttaatttaaaaaagttatcaatgtctaatcttatctttgattttcaatggatagttataagtatagtgggattaaacttgactacttgag |
34320123 |
T |
 |
| Q |
200 |
tgtgacggtggtgattaatcaattatttgcacactttatctgttaccataacatgcacgttttacactattgcaga |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34320122 |
tgtgacggtggtgattaatcaattatttgcacactttatctgttaccataacatgcacgttttacactattgcaga |
34320047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University