View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-61 (Length: 190)
Name: NF4302-Insertion-61
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-61 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 3e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 3e-68
Query Start/End: Original strand, 27 - 190
Target Start/End: Original strand, 30959421 - 30959583
Alignment:
| Q |
27 |
aagtggttgtttctctcatgataaacat----ggtgtataaacacaacttgcatatgacctcaatgcatatatttctttcattaactaaacataatgagg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30959421 |
aagtggttgtttctctcatgataaacatacatggtgtataaacacaacttgcatatgacctcaatgcatatatttctttcattaactaaacataatgagg |
30959520 |
T |
|
| Q |
123 |
agaattgcatgacatgtaaaatatgcaatgcacatagcctatatagtaagtatccccaagaatgcccc |
190 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30959521 |
agaattgcatgacatgtaaaat-----atgcacatagcctatatagtaagtatccccaagaatgcccc |
30959583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University