View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-62 (Length: 39)
Name: NF4302-Insertion-62
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-62 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 35; Significance: 0.000000000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 8544298 - 8544336
Alignment:
| Q |
1 |
tcattttcttcctatctttaattactgtttagaatctcc |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8544298 |
tcattttcttcctatctttaattactgtttacaatctcc |
8544336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 8609537 - 8609575
Alignment:
| Q |
1 |
tcattttcttcctatctttaattactgtttagaatctcc |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8609537 |
tcattttcttcctatctttaattactgtttacaatctcc |
8609575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University