View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-63 (Length: 36)
Name: NF4302-Insertion-63
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-63 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 33; Significance: 0.0000000001; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.0000000001
Query Start/End: Original strand, 4 - 36
Target Start/End: Original strand, 43829061 - 43829093
Alignment:
| Q |
4 |
agttatttcatcccaattgttttgaacttcaat |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43829061 |
agttatttcatcccaattgttttgaacttcaat |
43829093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.00000003
Query Start/End: Original strand, 4 - 36
Target Start/End: Original strand, 43814297 - 43814329
Alignment:
| Q |
4 |
agttatttcatcccaattgttttgaacttcaat |
36 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
43814297 |
agttttttcatcccaattgttttgaacttcaat |
43814329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.00000003
Query Start/End: Original strand, 4 - 36
Target Start/End: Original strand, 43821592 - 43821624
Alignment:
| Q |
4 |
agttatttcatcccaattgttttgaacttcaat |
36 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
43821592 |
agttttttcatcccaattgttttgaacttcaat |
43821624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University