View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302-Insertion-8 (Length: 138)
Name: NF4302-Insertion-8
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302-Insertion-8 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 9e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 9e-65
Query Start/End: Original strand, 10 - 138
Target Start/End: Original strand, 30761432 - 30761560
Alignment:
| Q |
10 |
cagaatattcggagctaaaattgacaagatatttatatattatgtgctaaacttgggtgcgaaatcccggacgcacagctaaaagtgctaagattgtttg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30761432 |
cagaatattcggagctaaaattgacaagatatttatatattatgtgctaaacttgggtgcgaaatcccggacgcacagctaaaagtgctaagattgtttg |
30761531 |
T |
|
| Q |
110 |
ttaatgatgaaaactcttggcctaatcta |
138 |
Q |
| |
|
|||||||||||||||||||| |||||||| |
|
|
| T |
30761532 |
ttaatgatgaaaactcttggactaatcta |
30761560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University