View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302_high_12 (Length: 242)
Name: NF4302_high_12
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 42 - 225
Target Start/End: Complemental strand, 35899450 - 35899267
Alignment:
| Q |
42 |
atctcccggaatgtcactaatatttatgatggcaacatgaatatgaaatgagttatgattaactttcggcagcatgcaatttgtattttcttactttcgt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35899450 |
atctcccggaatgtcactaatatttatgatggcaacatgaatatgaaatgacttatgattagctttcggcagcatgcaatttgtattttcttactttcgt |
35899351 |
T |
 |
| Q |
142 |
gcacgcaattgagggttaaatcaagttacagtgtcaattaggataggaataagatcataataaatcgagtctcaaatgataaac |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35899350 |
gcacgcaattgagggttaaatcaagttacagtgtcaattaggataggaataagatcataataaatcgagtctcaaatgataaac |
35899267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University