View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302_high_5 (Length: 334)
Name: NF4302_high_5
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 15 - 140
Target Start/End: Complemental strand, 26798433 - 26798308
Alignment:
| Q |
15 |
gagcataatcatcatgacaatcgagtttatgatcattctcatttttcaacccaaaaacgcgattctcttgacatggaatcacgcagcttaccttcttcat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26798433 |
gagcataatcatcatgacaatcgagtttatgatcattctcatttttcaacccaaaaacgtgattctcttgacatggaatcacgcagtttaccttcttcat |
26798334 |
T |
 |
| Q |
115 |
cacatgcttctaaagtaaagtattcc |
140 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
26798333 |
cacatgcttctaaagtaaagtattcc |
26798308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 211 - 316
Target Start/End: Complemental strand, 26798239 - 26798134
Alignment:
| Q |
211 |
tttgtaaatttaaggggccatcgatggcagtgattatgcaactagcgtttcaaagcatgggaattgtgtatggagacctaggaacatcacctttgtatgt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26798239 |
tttgtaaatttaaggggccatcgatggcagtgattatgcaactagcgtttcaaagcatgggaattgtgtatggagacctaggaacatcacctttgtatgt |
26798140 |
T |
 |
| Q |
311 |
gtatac |
316 |
Q |
| |
|
|||||| |
|
|
| T |
26798139 |
gtatac |
26798134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University