View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302_low_13 (Length: 276)
Name: NF4302_low_13
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 5 - 222
Target Start/End: Original strand, 24340863 - 24341080
Alignment:
| Q |
5 |
ttacttgctcttaaggaccacaatataggctttccctagaggcacactcaaccagggcctctaagacaattgtccaatcatggttttgagattgtaaaac |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24340863 |
ttacttgctcttaaggaccacaagataggcttttcctagaggcacactcaaccagggcctataagacaattgtccaatcatggttttgagattgtaaaac |
24340962 |
T |
|
| Q |
105 |
cctgatcctcacacaataaagcctaactcatggctccggactaggtgtattgttttctaaccctaaaatctcacacccacaagcttgcttaattgatcgt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24340963 |
cctgatcctcacacaataaagcctaactcatggctccgaactaggtgtattgttttctaaccctaaaatctcacacccacaagcttgcttaattgatcgt |
24341062 |
T |
|
| Q |
205 |
tcacagtctttaacccac |
222 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
24341063 |
tcacagtctttaacccac |
24341080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University