View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4302_low_17 (Length: 233)

Name: NF4302_low_17
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4302_low_17
NF4302_low_17
[»] chr1 (1 HSPs)
chr1 (1-219)||(4664633-4664843)


Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 4664843 - 4664633
Alignment:
1 tgtgataaaatcgaaataatgaacttaatgttacagtaaaaaataactttacnnnnnnnnnnngttgtactggatcacatactttaccttattgcttcgt 100  Q
    ||||||||||| ||||||||||| ||||||||||||||||||||||||||||            || |||||||||||||||||||||||||||||||||    
4664843 tgtgataaaattgaaataatgaaattaatgttacagtaaaaaataactttactttttt------ttttactggatcacatactttaccttattgcttcgt 4664750  T
101 taatagattaatgttacnnnnnnnaaatatagtagatacttgttagtatattgttagaaggaaaggacaaaacctagatggcattggtctcaactctcca 200  Q
    |||||||||||||||||       ||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||||  | |||||||||||||    
4664749 taatagattaatgttactttttttaaa-ata-taaatacttgttagtatattgttagaaggaaaggacaaaacctagatggcacggatctcaactctcca 4664652  T
201 tgttgtgcatgtagaggat 219  Q
    |||||||||||||||||||    
4664651 tgttgtgcatgtagaggat 4664633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University