View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4302_low_17 (Length: 233)
Name: NF4302_low_17
Description: NF4302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4302_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 4664843 - 4664633
Alignment:
| Q |
1 |
tgtgataaaatcgaaataatgaacttaatgttacagtaaaaaataactttacnnnnnnnnnnngttgtactggatcacatactttaccttattgcttcgt |
100 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
4664843 |
tgtgataaaattgaaataatgaaattaatgttacagtaaaaaataactttactttttt------ttttactggatcacatactttaccttattgcttcgt |
4664750 |
T |
 |
| Q |
101 |
taatagattaatgttacnnnnnnnaaatatagtagatacttgttagtatattgttagaaggaaaggacaaaacctagatggcattggtctcaactctcca |
200 |
Q |
| |
|
||||||||||||||||| ||| ||| || |||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
4664749 |
taatagattaatgttactttttttaaa-ata-taaatacttgttagtatattgttagaaggaaaggacaaaacctagatggcacggatctcaactctcca |
4664652 |
T |
 |
| Q |
201 |
tgttgtgcatgtagaggat |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4664651 |
tgttgtgcatgtagaggat |
4664633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University