View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4303-Insertion-1 (Length: 52)
Name: NF4303-Insertion-1
Description: NF4303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4303-Insertion-1 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 45; Significance: 1e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-17
Query Start/End: Original strand, 4 - 52
Target Start/End: Complemental strand, 27567344 - 27567296
Alignment:
| Q |
4 |
attgctattgtgtatgtttatacaacataaaagaatgcaatgtcgagga |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27567344 |
attgctattgtgtatgtttatacaacataaaagaatgtaatgtcgagga |
27567296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University