View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4303-Insertion-2 (Length: 171)
Name: NF4303-Insertion-2
Description: NF4303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4303-Insertion-2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 3e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 3e-31
Query Start/End: Original strand, 57 - 145
Target Start/End: Original strand, 6451263 - 6451351
Alignment:
| Q |
57 |
ttcacaattcttgacttctcaacactttatatgcatgtgtgaattaaaaagaaaatatatagttatgtatgacattggttaatggttga |
145 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6451263 |
ttcacaattcttgacttctcaaaactttatatatatgtgtgaattaaaagaaaaatatatagttatgtatgacattggttaatggttga |
6451351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University