View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4303-Insertion-6 (Length: 162)
Name: NF4303-Insertion-6
Description: NF4303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4303-Insertion-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 9e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 9e-53
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 517155 - 517271
Alignment:
| Q |
1 |
tatgcttatgtatacattttggtttgaaaatagacttttcatttttgagtaaaatagatttttgtgtatgcttatgtat-acattgtggttttaactttg |
99 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
517155 |
tatgcttatgtatacattgtggtttgaaaatagacttttcatttttgagtaaaatagatttttgtgtatgcttatgtataacattgtggttttaactttg |
517254 |
T |
|
| Q |
100 |
acatgcataccttattt |
116 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
517255 |
acatgcataccttattt |
517271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 62 - 91
Target Start/End: Original strand, 517150 - 517179
Alignment:
| Q |
62 |
ttgtgtatgcttatgtatacattgtggttt |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
517150 |
ttgtgtatgcttatgtatacattgtggttt |
517179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University