View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4303-Insertion-8 (Length: 109)
Name: NF4303-Insertion-8
Description: NF4303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4303-Insertion-8 |
 | |
|
| [»] chr6 (3 HSPs) |
| |
|
| [»] scaffold0174 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 89; Significance: 2e-43; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 3709594 - 3709486
Alignment:
| Q |
1 |
ctactaacgtattggactcatcccacaatataggttcttacgcgttgtttgacaactgttatgtttggtggtatgaactctttgattgtctgatgtttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
3709594 |
ctactaacgtattggactcatcccacaatatgagttcttacgcgttgtttgacaactgttatgtttggtggtacgaactctttgattgtctgatgtttca |
3709495 |
T |
|
| Q |
101 |
gttttgttg |
109 |
Q |
| |
|
| ||||||| |
|
|
| T |
3709494 |
ggtttgttg |
3709486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 3 - 76
Target Start/End: Original strand, 6257236 - 6257309
Alignment:
| Q |
3 |
actaacgtattggactcatcccacaatataggttcttacgcg-ttgtttgacaactgttatgtttggtggtatga |
76 |
Q |
| |
|
|||||| ||||||||||||||| | || | ||||||||||| |||||||| ||||||| ||||||||||||||| |
|
|
| T |
6257236 |
actaacatattggactcatccctcgatctgagttcttacgcgtttgtttga-aactgttgtgtttggtggtatga |
6257309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 29
Target Start/End: Complemental strand, 17459230 - 17459203
Alignment:
| Q |
2 |
tactaacgtattggactcatcccacaat |
29 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
17459230 |
tactaacgtattggactcatcccacaat |
17459203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 2 - 72
Target Start/End: Original strand, 1745442 - 1745512
Alignment:
| Q |
2 |
tactaacgtattggactcatcccacaatataggttcttacgcgttgtttgacaactgttatgtttggtggt |
72 |
Q |
| |
|
||||||||||||||||||||||| |||| | |||||||||||| ||| ||||||| ||||||||||| |
|
|
| T |
1745442 |
tactaacgtattggactcatccctcaatctgagttcttacgcgtctcttggaaactgttgtgtttggtggt |
1745512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.000000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 2 - 52
Target Start/End: Complemental strand, 18629010 - 18628960
Alignment:
| Q |
2 |
tactaacgtattggactcatcccacaatataggttcttacgcgttgtttga |
52 |
Q |
| |
|
|||| |||||||||||||||||| |||| | ||||||||||||||||||| |
|
|
| T |
18629010 |
tactgacgtattggactcatccctcaatctgagttcttacgcgttgtttga |
18628960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 45
Target Start/End: Original strand, 48563261 - 48563304
Alignment:
| Q |
2 |
tactaacgtattggactcatcccacaatataggttcttacgcgt |
45 |
Q |
| |
|
||||||| ||||||||||||||||| || || |||||||||||| |
|
|
| T |
48563261 |
tactaacatattggactcatcccacgatctaagttcttacgcgt |
48563304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0174 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: scaffold0174
Description:
Target: scaffold0174; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 45
Target Start/End: Original strand, 30586 - 30629
Alignment:
| Q |
2 |
tactaacgtattggactcatcccacaatataggttcttacgcgt |
45 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||| |||||| |
|
|
| T |
30586 |
tactaacgtattggactcatcccacgatatgagttctaacgcgt |
30629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 45
Target Start/End: Complemental strand, 1029779 - 1029736
Alignment:
| Q |
2 |
tactaacgtattggactcatcccacaatataggttcttacgcgt |
45 |
Q |
| |
|
||||||||||||||||||||||||| || | |||||||||||| |
|
|
| T |
1029779 |
tactaacgtattggactcatcccacgatctgagttcttacgcgt |
1029736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University