View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4303_low_12 (Length: 323)
Name: NF4303_low_12
Description: NF4303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4303_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 98 - 307
Target Start/End: Complemental strand, 54256060 - 54255851
Alignment:
| Q |
98 |
gatttcatcgtcacaaatttataaaggtcaatctataatgtacaaataagataaattttgcatcatacgcaaaatagtttttaccatcataataatgtga |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||||||||||||| |
|
|
| T |
54256060 |
gatttcatcgtcacaaatttataaaggtcaatctataatgtacaaataagataaattttgcattatgcacaaaatagtttttaccatcataataatgtga |
54255961 |
T |
|
| Q |
198 |
aatatgataaatcttattgatcgaataagaaaaaacacactcatacacaatgcaaaactattttacttatacacattcgacaatcatttatttgtgttaa |
297 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54255960 |
aatatgataaatcttattgatccaataagagaaaacacactcatacacaatgcaaaactattttacttatacacattcgacaatcatttatttgtgttaa |
54255861 |
T |
|
| Q |
298 |
acatctttag |
307 |
Q |
| |
|
|||||||||| |
|
|
| T |
54255860 |
acatctttag |
54255851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University