View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4303_low_13 (Length: 320)
Name: NF4303_low_13
Description: NF4303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4303_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 45694587 - 45694897
Alignment:
| Q |
1 |
agaggctactgttagctccgtacactttttaaaaacttcttgaccttttctgctactctcactaagaacttgattggaagtttgatcaactttggataca |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45694587 |
agaggctactgttagctccgtacattttttaaaaacttcttgaccttttctgctactctcactaagaacttgattggaagtttgatcaactttggataca |
45694686 |
T |
|
| Q |
101 |
tcttctttgcaagcagaagtagaaacagtagtgtttttctcaagagatttcggctccaaaggtttcaaaccaaccctggatggctctactgactgatgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45694687 |
tcttctttgcaagcagaagtagaaacagtagtgtttttctcaagagatttcggctccaaaggtttcaaaccaaccctggatggctccactgactgatgac |
45694786 |
T |
|
| Q |
201 |
aatgtatggctgaactctttggacattctccacttaaatcaacttttgatgattcgcaaggattccttcctattgcagctgcatctttgttctttgctcc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45694787 |
aatgtatggctgaactctttggacattctacacttaaatcaacttttgatgattcgcaaggattccttcctattgcagctgcatctttgttctttgctcc |
45694886 |
T |
|
| Q |
301 |
cacaggttctg |
311 |
Q |
| |
|
|||| |||||| |
|
|
| T |
45694887 |
cacacgttctg |
45694897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 189
Target Start/End: Complemental strand, 37934670 - 37934621
Alignment:
| Q |
140 |
tcaagagatttcggctccaaaggtttcaaaccaaccctggatggctctac |
189 |
Q |
| |
|
||||| |||||||||| ||||||||||||| || || ||||||||||||| |
|
|
| T |
37934670 |
tcaagcgatttcggctgcaaaggtttcaaatcagccttggatggctctac |
37934621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University