View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4303_low_14 (Length: 318)
Name: NF4303_low_14
Description: NF4303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4303_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 172 - 302
Target Start/End: Complemental strand, 54614393 - 54614263
Alignment:
| Q |
172 |
agtctttcacttacacctataacaatattgttagggtcaacccaaccaacatcgttgactctttgataatcaagattaagaggacaatgttcttctaaca |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54614393 |
agtctttcacttacacctataacaatattgttagggtcaacccaaccaacatcgttgactctttgataatcaagattaagaggacaatgttcttctaaca |
54614294 |
T |
 |
| Q |
272 |
tccaatcataaacatgaaccatgcaaccatg |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
54614293 |
tccaatcataaacatgaaccatgcaaccatg |
54614263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 54088483 - 54088374
Alignment:
| Q |
1 |
cctgctcctgacccagcccctgaccctgcacgagatcctgcatgggagctggcttcagaacctgctccagaagaccctgatcccgatcctgatcctgaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54088483 |
cctgctcctgacccagcccctgaccctgcacgagatcctgcatgggagccggcttcagaacctgctccagaagaccctgatcccgatcctgatcctgaag |
54088384 |
T |
 |
| Q |
101 |
tggaagccga |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
54088383 |
tggaagccga |
54088374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University