View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4303_low_8 (Length: 386)
Name: NF4303_low_8
Description: NF4303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4303_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 141 - 381
Target Start/End: Original strand, 20623033 - 20623273
Alignment:
| Q |
141 |
ctagtggtatgtttttcgatgtccacgaatgccaaataataatcagtttaactgtatgacagattttgtaatatatcttggtgatgtcattactgctaac |
240 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||||||||| ||||| | |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20623033 |
ctagtggtatgattttcaatgtctacgaatgccaaatactaatctggttaactatatgacagattttgtaatatatcttggtgatgtcattactgctaac |
20623132 |
T |
 |
| Q |
241 |
aatataatgattggaaatgcaagtttgtattgggatcaagcaacctctccagcaagaaataggggcataccttgggctagtgtatttggaaaccatgatg |
340 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
20623133 |
aatataatgattgaaaatgcaagtttgtattgggatcaagcaacctctccagcaagaaatcgaggcattccttgggctagtgtattcggaaaccatgatg |
20623232 |
T |
 |
| Q |
341 |
atgctccatttcagtggccattggactggttctctgctcct |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20623233 |
atgctccatttcagtggccattggactggttctctgctcct |
20623273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University