View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4304-Insertion-12 (Length: 110)
Name: NF4304-Insertion-12
Description: NF4304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4304-Insertion-12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 8e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 8e-40
Query Start/End: Original strand, 22 - 108
Target Start/End: Complemental strand, 27422586 - 27422500
Alignment:
| Q |
22 |
ggaagaatgaaattcaatacgttctttgcttaagaacttaaaatttcctcaagcaaaatatttagcatgaatggtaggagacaacca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27422586 |
ggaagaatgaaattcaatacgttctttgcttaagaacttaaaatttcctcaagcaaaatatttagcctgaatggtaggagacaacca |
27422500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University