View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4304-Insertion-15 (Length: 164)
Name: NF4304-Insertion-15
Description: NF4304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4304-Insertion-15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 16 - 164
Target Start/End: Complemental strand, 44079813 - 44079673
Alignment:
| Q |
16 |
caatgatgaggatatactacaaacaacagtacatttagatggatgatgctctctatttggtctcctaagctgagatgtgtaattgtgtatgattactatc |
115 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
44079813 |
caatgatgaggatatactacatacaacagtacatttagatggatgatgctctctatttggtctcctaagctgagatg--------tgtatgattactctc |
44079722 |
T |
 |
| Q |
116 |
catcctcaatatcttctattgttggctaatcaacccagggtcttcataa |
164 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44079721 |
catgctcaatatcttctattgttggctaatcaacccagggtcttcataa |
44079673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University