View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4304-Insertion-15 (Length: 164)

Name: NF4304-Insertion-15
Description: NF4304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4304-Insertion-15
NF4304-Insertion-15
[»] chr3 (1 HSPs)
chr3 (16-164)||(44079673-44079813)


Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 16 - 164
Target Start/End: Complemental strand, 44079813 - 44079673
Alignment:
16 caatgatgaggatatactacaaacaacagtacatttagatggatgatgctctctatttggtctcctaagctgagatgtgtaattgtgtatgattactatc 115  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||| ||    
44079813 caatgatgaggatatactacatacaacagtacatttagatggatgatgctctctatttggtctcctaagctgagatg--------tgtatgattactctc 44079722  T
116 catcctcaatatcttctattgttggctaatcaacccagggtcttcataa 164  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||    
44079721 catgctcaatatcttctattgttggctaatcaacccagggtcttcataa 44079673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University