View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4304-Insertion-20 (Length: 215)
Name: NF4304-Insertion-20
Description: NF4304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4304-Insertion-20 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 5177807 - 5178021
Alignment:
| Q |
1 |
tatacatggaagcccctcttgagaatccactgcttttcctgattttacaaagttaaattatatggttatgtatattgttaacatatggttttcaactgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5177807 |
tatacatggaagcccctcttgagaatccactgcttttcctgattttacaaagttaaattatatggttatgtatattgttaacatatggttttcaactgca |
5177906 |
T |
|
| Q |
101 |
taatgattgagatgcaaatatttgtaccttcttaaatgagcaacgtattctagtctagtcattttcttcatttcctcaagttccttttgataattttcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5177907 |
taatgattgagatgcaaatatttgtaccttcttaaatgagcaacgtattctagtctagtcattttcttcatttcctcaagttccttttgataattttcca |
5178006 |
T |
|
| Q |
201 |
actataattatcatg |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5178007 |
actataattatcatg |
5178021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 125 - 203
Target Start/End: Complemental strand, 40190276 - 40190198
Alignment:
| Q |
125 |
taccttcttaaatgagcaacgtattctagtctagtcattttcttcatttcctcaagttccttttgataattttccaact |
203 |
Q |
| |
|
|||||||||||||||||||| ||||| |||| ||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40190276 |
taccttcttaaatgagcaacatattcctgtcttgtcatattcttcatttcctcaagttgattttgataattttccaact |
40190198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 43
Target Start/End: Complemental strand, 40190384 - 40190344
Alignment:
| Q |
3 |
tacatggaagcccctcttgagaatccactgcttttcctgat |
43 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
40190384 |
tacatggatgcccctcttgagaatccactgctttttctgat |
40190344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University