View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4304-Insertion-22 (Length: 91)
Name: NF4304-Insertion-22
Description: NF4304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4304-Insertion-22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 2e-36
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 2267113 - 2267189
Alignment:
| Q |
8 |
ttatgtttcatgattgactatgtttcaatttcgatttggtttctattgattcatgattaggttcggttaggtttttc |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2267113 |
ttatgtttcatgattgactatgtttcaatttcgatttggtttctattgattcatgattaggttcggttaggtttttc |
2267189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University