View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4304-Insertion-25 (Length: 85)
Name: NF4304-Insertion-25
Description: NF4304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4304-Insertion-25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 6e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 6e-40
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 1458414 - 1458496
Alignment:
| Q |
1 |
ggagtatgctcctctcaaggtctccctctagtaccaatttcgttgggctagtccataccgagtcttcttgctctggctttaaa |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1458414 |
ggagtatgctcctctcaaggtctccctctagtaccaatttcgttgggctagtccataccgagtcttcttgctctggctttaaa |
1458496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 83; E-Value: 6e-40
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 2428121 - 2428203
Alignment:
| Q |
1 |
ggagtatgctcctctcaaggtctccctctagtaccaatttcgttgggctagtccataccgagtcttcttgctctggctttaaa |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2428121 |
ggagtatgctcctctcaaggtctccctctagtaccaatttcgttgggctagtccataccgagtcttcttgctctggctttaaa |
2428203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 83
Target Start/End: Original strand, 1191580 - 1191637
Alignment:
| Q |
23 |
tccctctagtaccaatttcgttgggct-agtccataccgagtcttcttgctctggctttaaa |
83 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
1191580 |
tccctctagtaccaatttcggtgggctaagtccatacagagt----ttgctctggctttaaa |
1191637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 35 - 62
Target Start/End: Original strand, 699737 - 699764
Alignment:
| Q |
35 |
caatttcgttgggctagtccataccgag |
62 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
699737 |
caatttcgttgggctagtccataccgag |
699764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University